Transcrição do DNA
 Introdução
 Tarefa
 Processo
 Avaliação
 Conclusão
 Créditos
 

1. Qual o nome da enzima responsável por orientar o emparelhamento dos ribonucleotídeos?

2. Denomina-se de transcrição o processo no qual uma molécula de RNA é formada utilizando o que como base?

3. Sabe-se que o emparelhamento dos ribonucleotídeos obedece a algumas regras e que as bases nitrogenadas de uma molécula de RNA obedecem à sequência determinada pelo DNA. Baseando-se nisso, qual a sequência de bases de um RNA formado a partir do seguinte molde de DNA:

                                             TCGTAGGTACCGCTACGTTAGACA

4. A transcrição pode ser dividida em três importantes etapas. Que nome recebe a fase em que ocorre a incorporação de nucleotídeos a partir da complementariedade com o DNA-molde?

5.A fase de iniciação começa quando a RNA polimerase reconhece no DNA a região que marca o início da transcrição. Que nome recebe essa região?

6."Cada molécula de RNA mensageiro é uma longa sequência de nucleotídeos idêntica ao DNA." Essa afirmação está corre? Justifique sua resposta.


© 2010 Todos direitos reservados.